Vol. 15, #1

Mechanisms Of Electroacupuncture-Induced
Ocular Hypotension
Teh-Ching Chu, PhD
Robin Socci, PhD
Jane Chu, BS
Craig Crosson, PhD
Qin Xu, BS

ABSTRACT
Background     Electroacupuncture (EA) has been studied with regard to intraocular pressure (IOP), but outflow facility has not been investigated.
Objectives     To examine the effects of EA on aqueous humor dynamics, and to determine the underlying mechanism(s) responsible for the ocular hypotension induced by low-frequency electrical stimulation.
Design, Subjects, and Outcomes     New Zealand white and Dutch-Belted rabbits received EA at the Huantiao point (GB 30). In sham experiments, needles were inserted without stimulation at a site 2 in from the active point. IOP was measured before and after EA. Aqueous humor flow rates were measured in the rabbits' eyes. Outflow facility was determined in anesthetized rabbits. Sprague-Dawley rats were used in experiments of IOP and gene expression. Blood pressure was measured before and after EA. Reverse transcription polymerase chain reaction (RT-PCR) was used to examine the expression of brain natriuretic peptide (BNP).
Results     When EA (3 Hz, 1 V) stimulation was applied for 1 h, the maximum IOP reduction was 9 mm Hg at 2 h; this hypotension lasted for 9 h. A 1-h application of EA induced a decrease in the aqueous humor flow rate of 42% from a mean (SE) basal value of 2.3 (0.3) µL/min (n=4). This reduction lasted 3 h, after which the aqueous flow rate gradually returned to the basal level. After EA, there was a 42% increase of outflow facility compared with the control. EA stimulation caused an increase of aqueous endorphin levels from a mean (SE) basal level of 0.91 (0.3) ng/mL, which peaked at 2 h but was still elevated at 5 h. In Dutch-Belted rabbits, there was an elevation of BNP immediately after EA, which returned to basal levels after 30 min. However, in the New Zealand white rabbits, the elevation was more gradual, rising at 0 and 30 min after EA. In rats, at 6 h after EA, the arterial blood pressure remained 10 mm Hg below the control value. The maximum EA-induced reduction of mean arterial blood pressure at 1 h was 18 mm Hg. RT-PCR results showed that BNP mRNAs were expressed in the rat ciliary body, retina, and brainstem.
Conclusions     Endogenous enkephalin and BNP are involved in the bilateral aqueous humor dynamics and blood pressure responses induced by EA. The presumed mechanisms of action of EA involve increased endorphin levels and BNP in aqueous humor. Based on the current studies in rabbits and rats, acupuncture is suggested as an adjuvant treatment of glaucoma. However, further investigations are required to determine the value and efficacy of acupuncture treatments in humans.
KEY WORDS
Brain Natriuretic Peptide, Endorphin/Enkephalin, Electroacupuncture, Ocular, Aqueous Humor Dynamics, Gene Expression, Intraocular Pressure

INTRODUCTION
Traditional Chinese Medicine, including acupuncture, has been practiced for thousands of years. Acupuncture and electroacupuncture (EA) have been used to treat a wide range of diseases and conditions.1 Previous studies have shown that acupuncture needling alone, and with electrical stimulation, provides relief in a variety of medical conditions including pain, depression, drug addiction, gastrointestinal disorders, anxiety, and cerebrovascular accident.2 The effects of EA on aqueous humor dynamics, such as intraocular pressure (IOP) and aqueous humor flow, have been investigated;3 however, the influence of outflow facility has not been investigated.

Natriuretic peptides are involved in the regulation of blood pressure and fluid homeostasis through receptor-mediated second messenger pathways.4-6 The natriuretic peptide family is composed of atrial natriuretic peptide, brain natriuretic peptide (BNP), and C-type natriuretic peptide. The expression of natriuretic peptides and natriuretic receptors has been studied in both rat and rabbit eyes.7,8 It has also been shown that natriuretic peptides and their receptors are expressed in human nonpigmented ciliary epithelial cells; these peptides may play a role in regulating IOP and aqueous humor secretion.9 Intravitreal injection of natriuretic peptides reduces IOP in rabbit, bovine, and human eyes.10-15 Furthermore, the mechanism for BNP-induced ocular hypotension is mediated through increased outflow facility.13

Previous studies demonstrated that the pain relieved by acupuncture was due to the elevation of endorphin levels in the brain.16,17 It has been shown that the preproenkephalin (PPE) mRNAs were expressed in the rostral ventrolateral medulla.18 In addition, the PPE mRNAs in the brain were enhanced by EA.19 Previous studies demonstrated that BNP mRNAs were expressed in the retina and ciliary body of rats.7 Therefore, it is hypothesized that EA-induced IOP-lowering effects modify aqueous humor inflow, outflow facility, and neuroendocrine function and gene expression (beta-endorphin, BNP). 

The purpose of this study was to examine the effects of EA on aqueous humor dynamics and determine the underlying mechanism(s) responsible for the ocular hypotension induced by low-frequency electrical stimulation. In this study, we investigated: (1) the consequences of EA on IOP, aqueous humor inflow and outflow facility, and bloodpressure; and (2) alterations of beta-endorphin and BNP levels in aqueous humor and gene expression (BNP and enkephalin) elicited by EA stimulation. Additionally, the antiglaucoma agent brimonidine wasused to lower IOP in rabbits,20 and we determined the elevation of BNP levels in aqueous humor.

Table 1. PCR Reaction Conditions and Primer Sequences for Quantitative Real-Time RT-PCR

mRNA*
[Genebank No.]

Ta, °C

Tm, °C

Primer Sequences (5'-3')

BNP (302 bp)
[M25297]

60

94

Forward: CTGCTGGAGCTGATAAGAGAAA
Reverse: CAGAGCTGGGGAAAGAAGAG

PPE (527 bp)
[Y07503]

55.2

94

Forward: TTGGGTCCTGCCTCCTG
Reverse: CCCATACCTCTTGCTCGTG

GAPDH (450 bp)
[X02231]†

57

94

Forward: ACCACAGTCCATGCCATCAC
Reverse: TCCACCACCCTGTTGCTGTA

Abbreviations: BNP, brain natriuretic peptide; bp, base pair; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PCR, polymerase chain reaction; PPE, preproenkephalin; Ta, annealing temperature; Tm, melting temperature.
*A previous denaturing cycle at the melting temperature was performed for 4 min, reactions were run for 40-45 cycles followed by an elongation at 72°C for 10 min.
†Housekeeping gene for normalization.


METHODS
Animals
New Zealand White and Dutch-Belted rabbits (2.5-4.0 kg) of either sex were used in this study. Sprague-Dawley rats (200-300 g) were maintained on a normal 12-h light/12-h dark cycle, and used in IOP and gene expression experiments. Animal care and treatment were conducted in accordance with the resolutions regarding use of animals for research established by the Association for Research in Vision and Ophthalmology (available at www.arvo.org).

Figure 1. Scheme for the location of acupuncture points in the leg of a rabbit.



Electroacupuncture
The rabbits' thighs were shaved the day before the experiment. Local anesthesia of the area was achieved with 0.5 mL of 2% lidocaine; acupuncture needles were then applied to the designated area of Huantiao (GB 30) acupuncture point of the leg (Figure 1). The Huantiao point (lesser-Yang Gallbladder muscle channel, GB 30) was located at the junction of the lateral 1/3 and medial 2/3 of the distance between the prominence of the great trochanter and the hiatus of the sacrum near the sciatic nerve. (The authors have applied sterilized acupuncture needles [34 gauge x 1.0 in] to human legs without subject discomfort.) In rabbits, sciatic nerves were stimulated with needles connected to a Grass SD9 stimulator that provided electrical impulses (3 Hz, 1 V) for 1 h. During EA, rabbits were restrained gently by hand in a quiet environment. For the sham IOP experiments, acupuncture needles were inserted without EA stimulation and 2 in away from the sciatic nerve. The acupuncture sites showed no signs of inflammation. Rabbits were able to move without discomfort immediately after the procedure. The initial experiments investigated the effects of acupuncture needling (without electrical stimulation) on IOP. Sterilized acupuncture needles were inserted perpendicularly to a depth of 0.8 in into the leg muscles of rabbits. The acupuncture needles were rotated clockwise 1 full turn every 20 min for up to 1 h. Acupuncture needles were applied similarly to rats.

IOP Measurements
IOP (in mm Hg) was measured before and after EA using a calibrated pneumatonometer (Model 30, Mentor Co, Norwell, Mass). Tetracaine (0.1%, 25 µL) was applied to each cornea before the IOP measurements to minimize discomfort. IOP was measured by pneumatonometry in normal rabbits (n=4). Two baseline readings were taken at 1.0 and 0 h before EA administration; post-EA determinations of ocular pressures were made at 1, 2, 3, 4, 5, and 6 h. At the end of each series of IOP measurements, stability of the tonometry was confirmed using the verifier supplied by the manufacturer.We also investigated the effect of topically applied brimonidine (0.2%), a selective a2-adrenergic agonist,21 on IOP.

Blood Pressure Measurements
Tail-cuff plethysmography (Harvard Apparatus, Inc, Holliston, Mass) was used to measure indirect blood pressure in rats;22 heart rate was measured from the arterial pulse wave at the same time. A control arterial pressure reading was obtained prior to EA. Immediately after EA, mean arterial pressure was measured hourly for 6 h.

Aqueous Humor Flow
The laboratory showed that the IOP-lowering effect of several drugs that inhibit sympathoadrenal activity is associated with reduction of the aqueous humor flow rate.23,24 Aqueous humor flow rates were measured in rabbit eyes using fluorescein dilution as quantified by a Fluorotron Master (Ocumetrics, Palo Alto, Calif). The uniform stromal depot method (previously described)25 was used to load fluorescein into the eyes. (The general method of fluorometric measurement and calculation of aqueous humor flow rate used have also been previously described.23,26) In the current set of experiments, basal control recordings of flow rate were established in the 1st week. The following week, IOP measurements and flow rates in both eyes were determined. Fluorometric recordings started at -1 and 0 h before EA administration; subsequent recordings were made at 1-h intervals for 4 h.

Beta-Endorphin and BNP Levels
Removal of aqueous humor samples from rabbits by paracentesis has been previously described.27 Prior to the paracentesis procedure,groups of rabbits were subjected to 1 h of EA and then rapidly killed with an overdose of sodium pentobarbital at the appropriate times. A clean, previously autoclaved Hamilton microliter syringe and a 30-gauge x 0.5 in. acupuncture needle were used for aspiration of aqueous humor (which was quickly transferred to small vials containing aprotinin and phenylmethylsulfonylfluoride and placed in ice). Betaendorphin samples were collected prior to EA (control) and subsequently at 1, 2, and 5 h after, and analyzed by enzyme immunoassay (Peninsula Laboratory Inc, San Carlos, Calif). BNP samples were collected prior to EA (control) and 0 and 30 min after. Tissues also collected for BNP measurement were immediately homogenized in solution containing aprotinin and phenylmethylsulfonylfluoride on ice, and centrifuged (3000g, 25 min at 48C). Aqueous samples and tissue supernatants were used in the radioimmunoassay (Peninsula Laboratory). Aqueous humor levels of beta-endorphin and BNP were expressed as ng/mL. After determination of protein using the Bio-Rad assay, tissue BNP levels were expressed as pg/mg of protein. In other experiments, the effect of topically applied brimonidine (0.2%) on BNP levels was investigated.

Figure 2. Acupuncture needling for 1 h induced the intraocular pressure (IOP)-lowering effects in the left and right eyes of normal New Zealand white rabbits. The control IOP was 20 (3) mm Hg. Asterisk (*) denotes significant difference (P<.05) from control.

Figure 3. Effect of topically applied brimonidine (0.2%) on intraocular pressure (IOP) in normal New Zealand white rabbits. Asterisk (*) denotes significant difference (P<.05) from control.

Figure 4. Enhancement of outflow facility at 2 h by electroacupuncture (EA)
(3 Hz, 1V, 1 h) in normal New Zealand white rabbits. Asterisk (*) denotes significant difference (P<.05) from control.


Outflow Facility
Total outflow facility was determined by 2-level (5 and 15 mm Hg above spontaneous IOP) constant pressure perfusion following the method described previously.28 In anesthetized rabbits (33 mg/kg ketamine and 6 mg/kg xylazine, intramuscularly), the corneas were anesthetized with 50 µL of 0.5% proparacaine, and the anterior chambers were cannulated with needles and perfused with artificial Bárány aqueous humor solution by a constant pressure that was alternately applied at 10-min intervals. After IOP was stabilized, baseline facility was determined for 30 min. Bárány solution (10 µL) was simultaneously injected into the contralateral eye. Outflow facility (µL/min/mm Hg) was determined at 2, 4, and 6 h after the administration of EA needling at the sciatic nerve. The constant pressure perfusion technique is generally considered the most reliable method for determining total facility but requires cannulation of the eye.

Quantitative Real-Time Reverse Transcription-Polymerase
Chain Reaction (RT-PCR) Analysis
To examine the expression of BNP and PPE, the protocol described previously7,9 was used. Briefly, total RNA (1 µg), isolated using the RNAzol B method (Tel-Test, Friendswood, Tex),29 was reverse transcribed into 1st-strand complementary DNA (cDNA) by using Advantage RT-for-PCR kit (Clontech Laboratories Inc, Palo Alto, Calif). Three microliters of cDNA product was used for quantitative real-time RT-PCR amplification in a final volume of 25 µL by using Taq PCR Core kit (Qiagen Inc, Chatsworth, Calif), using a DNA thermocycler (iCycler, BioRad Inc).30 The PCR primers were designed based on published cDNA nucleotide sequences using the DNAstar program (DNAstar Inc), and obtained from Invitrogen (Carlsbad, Calif) (Table 1). Cycle numbers obtained at the log-linear phase of the reaction were plotted against a standard curve prepared with serially-diluted control samples. Expression levels of target genes were normalized by concurrently measured glyceraldehyde-3-phosphate dehydrogenase mRNA levels.

Statistical Analysis
The statistical comparisons of EA-induced changes were made using an analysis of variance formultiple group comparisons, followed by a Student-Newman-Keuls test (Instat program, GraphPad Software, San Diego, Calif). The level of significance was set as P<.05. Data are presented as mean (SE) calculated from multiple determinations.

Figure 5. Effect of electroacupuncture (EA) on aqueous levels of beta-endorphins in normal New Zealand white rabbits (n=4). Asterisk (*) denotes significant difference (P<.05) from control.

Figure 6. Effect of electroacupuncture (EA) on aqueous levels of brain natriuretic peptide (BNP) in normal Dutch-Belted and New Zealand white rabbits (n=4). Asterisk (*) denotes significant difference (P<.05) from control.



RESULTS
IOP
Initially, the effects of acupuncture without electrical stimulation on IOP were investigated. After inserting acupuncture needles for 1 h, there was maximum reduction in IOP between 1 and 2 h bilaterally (Figure 2). In sham experiments, acupuncture needles inserted away from the sciatic nerve produced no change in IOP (Figure 2). When EA (3 Hz, 1 V) stimulation was applied for 1 h, the hypotensive effect was larger and more prolonged. The maximum IOP reduction was 9 mm Hg at 2 h; this hypotension lasted for 9 h.3 For comparison, the effect of topically applied brimonidine (0.2%) on IOP was examined. The IOP was reduced to a maximum of 10 mm Hg at 2 h; it returned to the level of the saline control by 4 h (Figure 3).

Aqueous Humor Flow Rate
To identify potential mechanisms for the EA-induced ocular hypotension, aqueous humor flow rate was measured. Previously, our laboratory demonstrated that various drugs that lower IOP also reduce the aqueous humor flow rate.23,24,31 In New Zealand white rabbits, a 1-h application of EA induced a decrease in the aqueous humor flow rate of 42% from a basal value of 2.3 (0.3) µL/min (n=4). This reduction lasted 3 h, after which the aqueous flow rate gradually returned to the basal level.

Outflow Facility by EA
Because the decreased effect on aqueous flow rate was one of the factors contributing to the reduction in IOP, the other factor, alteration of outflow facility induced by the action of EA, was also examined. The maximum reduction of IOP by EA in rabbits occurred at 2 h; therefore, outflow facility was determined to correspond to the IOP data. After EA application, there was a 42% increase of outflow facility compared with the control (Figure 4).

Role of Opioid andNatriuretic Peptide Receptorsin EA-Induced Changes in Ocular Hydrodynamics
To confirm whether the release of beta-endorphin and BNP played a role in the EA-induced ocular hypotension, aqueous humor levels were determined by immunoassay. EA stimulation caused an increase of aqueous endorphin levels from 0.91 (0.3) ng/mL, which peaked at 2 h but was still elevated at 5 h (Figure 5).
BNP was measured in the aqueous humor of both Dutch-Belted (pigmented) and New Zealand white (albino) rabbits (Figure 6). In Dutch-Belted rabbits, BNP was elevated immediately after EA, which returned to basal levels after 30 min. However, in the New Zealand white rabbits, the elevation was more gradual, rising at 0 and 30 min after EA. To investigate potential sites of BNP release, the effect of EA on BNP levels in the retina, ciliary processes, and iris was investigated. In both strains of rabbit, BNP levels in the retina, ciliary processes, and iris were reduced over time after EA (data not shown).
For comparison, the effect of an IOP-lowering drug, the selective a2-adrenergic agonist brimonidine, on aqueous BNP levels was examined in New Zealand white rabbits (Figure 7). Topically applied brimonidine (0.2%) elevated aqueous BNP levels at 30 min and 1 h. Brimonidine treatment produced reductions in BNP levels in retina and ciliary processes, but not in the iris (data not shown).

Arterial Blood Pressure Changes Induced by EA
Acupuncture needling has been shown to reduce blood pressure in hypertensive rats32 and humans.33 We examined the effects of EA on mean arterial blood pressure in normal, unanesthetized Sprague-Dawley rats. EA caused a substantial decline in blood pressure compared with that in the sham rats (Figure 8). At 6 h after EA, the arterial pressure remained 10 mm Hg below the control value. The maximum
EA-induced reduction of mean arterial blood pressure at 1 h was 18 mm Hg. There was no effect of EA on heart rate (data not shown).

Expression of BNP and PPE
by EA in Rat Brain Stem, Ciliary Body, and Retina
Previous studies7 demonstrated that BNP mRNA was expressed in the retina and ciliary body of the rat; however, we are unaware of studies of PPE expression in the eye. Our RT-PCR results showed that BNP and PPE mRNAs were expressed in the ciliary body, retina, and brainstem. Quantitative RT-PCR analysis of the mRNA expression levels of BNP (Figure 9) revealed an acute up-regulation induced by EA. However, mRNA expression levels for PPE were enhanced in the retina and brainstem, but not in the ciliary body (Figure 10).

Figure 7. Effect of 0.2% brimonidine on aqueous levels of brain natriuretic peptide (BNP) in normal New Zealand white rabbits (n=4). Asterisk (*) denotes significant difference (P<.05) from control.

Figure 8. Effect of electroacupuncture (EA) on arterial blood pressure in normal unanesthetized Sprague-Dawley rats. Control blood pressure was 113 (7) mm Hg (n=5). Asterisk (*) denotes significant difference (P<.05) from control.



DISCUSSION
Although some forms of acupuncture have been practiced for an estimated 4,500 years, the biological mechanisms responsible for the clinical effects of acupuncture, other than analgesia, have not been extensively studied.34,35 Nevertheless, there is extensive evidence to suggest that there is a role for endogenous opioids in the beneficial effects produced by acupuncture in back pain, depression during pregnancy, osteoarthritis of the knee, and hypertension. In the therapy of hypertension and glaucoma, acupuncture has produced a long-lasting reduction in sympathetic nerve activity by releasing endogenous opioids,36 thereby providing a safe and effective complementary treatment. Alternatively, a major mechanism mediating the blood pressure or IOP-lowering effect of acupuncture is the activation of somatic afferents, which triggers analoxone-sensitive reflex suppression of central sympathetic outflow. Thus, in this study, we sought to determine whether acupuncture could induce changes in ocular hydrodynamics.

Exercise has been shown to induce ocular hypotension,37 but the mechanism(s) involved is not understood. Because EA can induce certain neuroendocrine aspects of exercise, this study was performed to determine whether alterations of IOP could occur as a result of activating the sciatic nerves. We observed that traditional acupuncture needling, including rotating, lifting, and thrusting in the thigh, produced ocular hypotension in rabbits. The intent of EA stimulation was to in crease the afferent nerve activity by electrically stimulating the sciatic nerves. After EA stimulation for 1 h, a substantial and more sustained bilateral depression of IOP was produced. Moreover, this study demonstrated that lowering of IOP can be elicited by a minimally invasive procedure that depresses sympathoadrenal activity and raises beta-endorphin levels. Therefore, it is important to determine in greater detail the potential mechanisms by which EA stimulation lowers IOP.

We chose the traditional acupuncture point, Huantiao (GB 30), because it offered more consistency and greater precision in terms of needle placement. The placement of the needles is as important in electrical stimulation as in manual manipulation. Although the electrical current spreads out from the needle, electrical stimulation of non-acupuncture points in sham experiments produced less ocular hypotension (data not shown). Future experiments will be required to confirm the conditions under which the reduction of IOP is related to the specific acupuncture point (Huantiao, GB 30).

A previous report demonstrated a depressor effect on blood pressure induced by acupuncture stimulation in anesthetized rabbits.38 Thus, it is of interest to identify other changes in bodily function that may be influenced by acupuncture. Results from this study suggest that lowering of IOP by EA stimulation is associated with reduction of blood pressure in normal, conscious rats. Further studies demonstrated the suppression of the rate of aqueous humor flow. As noted, when EA stimulation lowered IOP, a reduction of aqueous humor flow rate occurred during the early periods. Therefore, the ocular hypotension induced by EA stimulation in the late stages is most likely due to factors other than the change in formation rate of aqueous humor. Thus, other factors such as enhanced outflow facility may contribute to the ocular hypotensive effects at later periods. It is possible that outflow facility increases in response to elevated levels of beta-endorphin. This study demonstrated that EA stimulation enhanced outflow facility in response to the elevation of endogenous opioid levels in aqueous humor.

Other investigations showed evidence that beta-endorphins and enkephalins in the brain play a role in the EA-related modulation of cardiovascular reflex responses.2,39 A report of magnetic resonance imaging studies showed the correlation between acupuncture points and stimulation of the eye with the corresponding activity in the brain associated with visual function.40 This study demonstrated that the reduction of IOP by EA is correlated with an increase of endorphin levels in aqueous humor. Thus, our results indicate that endorphin release could account for part of the ocular hypotension caused by EA stimulation.

Finally, there is evidence that the neurobiological effects of acupuncture could enhance gene and protein expression in neurons,34,41 and the resulting increased generation of opioid peptides. Expression of the BNP and enkephalin was examined in rats because species-specific sequences were available for all the transcripts. Previous studies showed that BNP was found in the ciliary body and aqueous humor of rabbits, and its mRNAs were expressed in the retina and ciliary body of rats.7,10 We demonstrated that acute EA stimulation induced an increase in BNP levels in the aqueous humor of rabbits, and BNP expression of mRNA levels in the ciliary body was up-regulated by EA. Previously, it was demonstrated that the PPE was expressed in the brain and enhanced by EA.19 This study, for the first time using quantitative real-time RT-PCR analysis, demonstrated that PPE expression of mRNA levels in the retina and brain was up-regulated by the acute EA stimulation.

Figure 9. Effect of electroacupuncture (EA) on the expression of brain natriuretic peptide (BNP) mRNA in rat brainstem, ciliary body, and retina (n=3). Asterisk (*) denotes significant difference (P<.05) from control. GAPDH indicates glyceraldehyde-3-phosphate dehydrogenase.

Figure 10.Effect of electroacupuncture (EA) on the expression of preproenkephalin (PPE) mRNA in rat brainstem, retina, and ciliary body (n=3). Asterisk (*) denotes significant difference (P<.05) from control. GAPDH indicates glyceraldehyde-3-phosphate dehydrogenase.



CONCLUSION
We concluded that endogenous enkephalin and BNP were involved in the bilateral aqueous humor dynamics and blood pressure responses induced by EA. The presumed mechanisms of action of EA involve increased endorphin levels and BNP in aqueous humor. Based on the current studies in rabbits and rats, acupuncture is suggested as an adjuvant treatment of glaucoma. Because acupuncture treatment is well accepted for therapy of a variety of diseases, this approach may offer additional tools for the treatment of glaucoma, especially for patients intolerant of certain glaucoma medications. However, further investigation is required to determine the value and efficacy of acupuncture treatments in humans.

Funding/Support
This work was supported, in part, by grants from NIH/NEI (EY13159) and NIH S06GM08248. Chemicals used in this study were purchased from Sigma Chemical
Co. Brimonidine was a gift from Allergan Inc.

REFERENCES

  1. Bensky D. Introduction to Chinese medicine. In: O'Connor J, Bensky D, eds. Acupuncture: A Comprehensive Text. Seattle, Wash: Eastland Press; 1981:1-30.
  2. Ulett GA, Han S, Han JS. Electroacupuncture: mechanisms and clinical application. Biol Psychiatry. 1998;44:129-138.
  3. Chu TC, Potter DE. Ocular hypotension induced by electroacupuncture. J Ocul Pharmacol Ther. 2002;18:293-305.
  4. Bennett BD, Bennett GL, Vitangcol RV, et al. Extracellular domain-IgG fusion proteins for three human natriuretic peptide receptors. J Biol Chem. 1991;266: 23060- 23067.
  5. Koller KJ, Lowe DG, Bennett GL, et al. Selective activation of the B natriuretic peptide receptor by C-type natriuretic peptide (CNP). Science. 1991; 252:120-123.
  6. Koller KJ, Goeddel DV. Molecular biology of the natriuretic peptides and their receptors. Circulation. 1992;86:1081-1088.
  7. Fernandez-Durango R, Nunez DJR, Brown MJ. Messenger RNAs encoding the natriuretic peptides and their receptors are expressed in the eye. Exp Eye Res. 1995;61: 723-729.
  8. Salzmann J, Flitcroft D, Bunce C, Gordon D, Wormald R, Migdal C. Brain natriuretic peptide: identification of a second natriuretic peptide in human aqueous humour. Br J Ophthalmol. 1998;82:830-834.
  9. Ortego J, Coca-Prados M. Functional expression of components of the natriuretic peptide system in human ocular nonpigmented ciliary epithelial cells. Biochem Biophys Res Commun. 1999;258:21-28.
  10. Fernandez-Durango R, Trivino A, Ramirez JM,et al. Immunoreactive atrial natriuretic factor in aqueous humor: its concentration is increased with high intraocular pressure in rabbit eyes. Vision Res. 1990;30:1305-1310.
  11. Samuelsson-Almen M, Nilsson SFE, Maepea O, Bill A. Effects of atrial natriuretic factor (ANF) on intraocular pressure and aqueous humor flow in the cynomolgus monkey. Exp Eye Res. 1991;53:253-260.
  12. Wolfensberger TJ, Singer DRJ, Freegard T, Markandu ND, Buckley MG, MacGregor GA. Evidence for a new role of natriuretic peptides: control of intraocular pressure. Br J Ophthalmol. 1994;78:446-448.
  13. Takashima Y, Taniguchi T, Yoshida M, Haque MSR, Yoshimura N, Honda Y. Ocular hypotensive mechanism of intravitreally injected brain natriuretic peptide in rabbit. Invest Ophthalmol Vis Sci. 1996;37:2671-2677.
  14. Takashima Y, Taniguchi T, Yoshida M, et al. Ocular hypotension induced by intravitreally injected C-type natriuretic peptide. Exp Eye Res. 1998;66:89-96.
  15. Millar JC, Shahidullah M, Wilson WS. Atriopeptin lowers aqueous humor formation and intraocular pressure and elevates ciliary cyclic GMP but lacks uveal vascular effects in the bovine perfused eye. J Ocul Pharmacol Ther. 1997;13:1-11.
  16. Petti F, Bangrazi A, Liguori A, Reale G, Ippoliti F. Effects of acupuncture on immune response related to opioid-like peptides. J Tradit Chin Med. 1998;18:55-63.
  17. Yu Y, Kasahara T, Sato T, et al. Role of endogenous interferon-gamma on the enhancement of splenic NK cell activity by electroacupuncture stimulation in mice. J Neuroimmunol. 1998;90:176-186.
  18. Guyenet PG, Stornetta RL, Schreihofer AM, et al. Opioid signalling in the rat rostral ventrolateral medulla. Clin Exp Pharmacol Physiol. 2002;29:238-242.
  19. Zhu CB, Li XY, Zhu YH, Xu SF. Preproenkephalin mRNA enhanced by combination of droperidol with electroacupuncture. Zhongguo Yao Li Xue Bao. 1995;16:201-204.
  20. Burke JA, Potter DE. Ocular effects of a relatively selective alpha 2 agonist (UK-14,304-18) in cats, rabbits and monkeys. Curr Eye Res. 1986;5:665-676.
  21. Greenfield DS, Liebmann JM, Ritch R. Brimonidine: a new a2-adrenoreceptor agonist for glaucoma treatment. J Glaucoma. 1997;6:250-258.
  22. Ganafa AA, Socci RR, Eatman D, Silvestrov N, Abukhalaf IK, Bayorh MA. Effect of palm oil on oxidative stress-induced hypertension in Sprague-Dawley rats. Am J Hypertens. 2002;15:725-731.
  23. Chu TC, Ogidigben MJ, Potter DE. Oxymetazoline: potential mechanisms of inhibitory effects on aqueous humor dynamics. Pharmacology. 1996; 53:259-270.
  24. Chu E, Chu TC, Potter DE. Mechanisms and sites of ocular action of 7-hydroxy-2-dipropylaminotetralin: a dopamine3 receptor agonist. J Pharmacol Exp Ther. 2000;293:710-716.
  25. Yablonski ME, Zimmerman TJ, Waltman SR, Becker B. A fluorophotometric study of the effect of topical timolol on aqueous humor dynamics. Exp Eye Res. 1978;27:135-142.
  26. Brubaker R. Measurement of aqueous flow by fluorophotometry. In: Ritch R, Schield MB, Krupin R, eds. Glaucoma. St Louis, Mo: Mosby; 1989: 337-344.
  27. Chu E, Chu TC, Potter DE. Potential sites of action of TNPA: a dopamine-2 receptor agonist. Exp Eye Res. 1999;69:611-616.
  28. Crosson CE, Petrovich M. Contributions of adenosine receptor activation to the ocular actions of epinephrine. Invest Ophthalmol Vis Sci. 1999;40: 2054-2061.
  29. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987; 162:156-159.
  30. Wang W, Campos AH, Prince CZ, Mou Y, Pollman MJ. Coordinate notch3-hairy-related transcription factor pathway regulation in response to arterial injury: mediator role of platelet-derived growth factor and ERK. J Biol Chem. 2002;277:23165-23171.
  31. Russell KRM, Wang DR, Potter DE. Modulation of ocular hydrodynamics and iris function by bremazocine, a kappa opioid receptor agonist. Exp Eye Res. 2000;70:675-682.
  32. Zhou Y, Chen Q, Hou Z, Chen Y. Experimental research on treatment of hypertension with acupuncture. J Tradit Chin Med. 1993;13:277-280.
  33. Yao W, Liu H. Clinical observation on the immediate hypotensive effect of zanzhu point. J Tradit Chin Med. 1996;16:273-274.
  34. Kaptchuk TJ. Acupuncture: theory, efficacy, and practice. Ann Intern Med. 2002;136:374-383.
  35. Mayer DJ. Acupuncture: an evidence-based review of the clinical literature. Annu Rev Med. 2000;51:49-63.
  36. Kaplan NM. Acupuncture and hypertension: efficacy and mechanisms. In: Five-Year Strategic Plan. Bethesda, Md: National Center for Complementary & Alternative Medicine; 2001:30-31.
  37. Martin B, Harris A, Hammel T, Malinovsky V. Mechanism of exercise-induced ocular hypotension. Invest Ophthalmol Vis Sci. 1999;40:1011-1015.
  38. Kline RL, Yeung KY, Calaresu FR. Role of somatic nerves in the cardiovascular responses to stimulation of an acupuncture point in anesthetized rabbits. Exp Neurol. 1978;61:561-570.
  39. Li P, Tjeng-A-Looi S, Longhurst JC. Rostral ventrolateral medullary opioid receptor subtypes in the inhibitory effect of electroacupuncture on reflex autonomic response in cats. Auton Neurosci. 2001;89:38-47.
  40. Cho ZH, Chung SC, Jones JP, et al. New findings of the correlation between acupoints and corresponding brain cortices using functional MRI. Proc Natl Acad Sci U S A. 1998;95:2670-2673.
  41. Tsou K, Zheng M, Ding XH. Dynamic changes in the levels of striatal proenkephalin mRNA and large molecular weight enkephalin containing peptides following electroacupuncture. NIDA Res Monogr. 1986;75:385-388.

AUTHORS' INFORMATION
Teh-Ching Chu, PhD, is Associate Professor in the Department of Family Medicine/Pharmacology/Toxicology at Morehouse School of Medicine in Atlanta, Georgia.
Teh-Ching Chu, PhD, LAc*
Dipl in Ac & CH (NCCAOM)
Department of Family Medicine/Pharmacology/Toxicology
Morehouse School of Medicine
720 Westview Dr
Atlanta, GA 30310-1495
Phone: 404-752-1513 • Fax: 404-752-1164 • E-mail: tc@msm.edu

Robin Socci, PhD, is Research Associate with Dr Chu.
Robin R. Socci, PhD
Phone: 404-752-1556 • Fax: 404-752-1164 • E-mail: rsocci@msm.edu

Jane Chu, collaborator, is Research Coordinator in the RIMI program at Spelman College in Atlanta, GA.
Jane Chu, BS
Phone: 404-215-7915 • E-mail: jchu@spelman.edu

Craig Crosson, , PhD, collaborator, is Professor of Opthalmology at Medical University of South Carolina in Charleston, South Carolina.
Craig Crosson, PhD
Department of Ophthalmology, Storm Eye Institute-MUSC
167 Ashley Ave
Charleston, SC
Phone: 843-792-3134 • Fax: 843-792-1723 • E-mail: Crossonc@musc.edu

Qin Xu is Research Assistant with Dr Chu.
Qin Xu, BS
Phone: 404-752-1556 • Fax: 404-752-1164

*Correspondence and reprint requests

 

Home   Contact Information   Search

Copyright ©2001 American Academy of Medical Acupuncture. All Rights Reserved.